Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-Flag

Your Most Reliable & Cost-Effective Gene & Vector Supporting Partner


Gene Cloning Gene Synthesis


Expression Vector Construction


Plasmid Production


qPCR Primer Design & Testing

Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-Flag

Service: Construction of expression vector for insect cell / baculovirus expression
Required Material : Target protein gene provided by customer or ordered from Sino Biological
Vector Backbone: pFastBac vector optimized for insect cell expression
Cell Line: Suitable for expression in High Five cells, SF cells, and SF21 cells
DetectionTag: DYKDDDK-tag (FLAG-tag), refer to our FLAG-tag antibody
Purification Tag: DYKDDDK-tag (FLAG-tag), refer to our FLAG-tag antibody affinity resin
Deliverable: 10ug purified insect cell / baculovirus expression vector plasmid
Timeline: 1-2 weeks
Price Quote:  

pFastBac-N-Flag Insect Cell / Baculovirus Expression Vector Physical Map

pFastBac-N-Flag Insect Cell / Baculovirus Expression Vector Description

Schematic of cloning site on pFastBac-N-Flag Insect Cell / Baculovirus Expression Vector

pFastBac-N-Flag Insect Cell / Baculovirus Expression Vector Backbone DNA Sequence

gacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagcc ....... <Complete List of DNA Sequence>

Insect Cell / Baculovirus Expression Vector Construction

Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-Flag Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-His
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-His Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-HA
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-HA Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-Myc
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-Myc Insect Cell / Baculovirus Expression Vector Construction: pFastBac-untagged
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-Flag Insect Cell / Baculovirus Expression Vector Construction: pIZTV5-His

Related Molecule Biology Services

Biology CRO Service
Biology CRO Service Introduction
Antibody Production & Development CRO Service
Protein Production CRO Service
Transient Transfection Service: Mammalian Cell Culture
Molecular Biology CRO Service
Gene Expression Vector Construction CRO Service+
- Gene Expression Vector Construction Service Description
- Mammalian Cell Expression Vector Construction Service
- Insect Cell /Baculovirus Expression Vector Construction Service
Insect Cell Expression Vector Construction Service Description
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-Flag
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-His
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-HA
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-Myc
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-N-GST
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-Flag
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-His
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-HA
Insect Cell / Baculovirus Expression Vector Construction: pFastBac-C-Myc
Insect Cell / Baculovirus Expression Vector Construction: Untagged
Insect Cell / Baculovirus Expression Vector Construction: pIZTV5-His
- E. Coli. Expression Vector Construction Service
- Yeast Expression Vector Construction Service