Mammalian Expression Vector Construction Service: pCMV3-C-GFPSpark

Your Most Reliable & Cost-Effective Gene & Vector Supporting Partner


Gene Cloning Gene Synthesis


Expression Vector Construction


Plasmid Production


qPCR Primer Design & Testing

Mammalian Cell Expression Vector Construction Service: pCMV3-C-GFP

Service: Construction of expression vector for mammalian cells
Required Material : Target protein gene provided by customer or ordered from Sino Biological
Vector Backbone: Proprietary pCMV3 vector optimized for mammalian cell expression
Promoter: Optimized CMV promoter for highly efficient protein expression
DetectionTag: GFPSpark: enhanced green fluorescent protein (GFP)
For more information, refer to :GFP gene, protein, and antibody
Deliverable: 10ug purified mammalian cell expression vector plasmid
Timeline: 1-2 weeks
Price Quote:  

pCMV3-C-GFP Mammalian Expression Vector Physical Map

pCMV3-C-GFP Mammalian Expression Vector Description

Schematic of cloning site on pCMV3-C-GFP Mammalian Expression Vector

pCMV3-C-GFP Mammalian Expression Vector Backbone DNA Sequence

gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgagtacatttatattggctcatgtccaatatgaccgccatgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtccgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacaccaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaataaccccgccccgttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcctcactctcttccgcatcgctgtctgcgagggccagctgttgggctcgcggttgaggacaaactcttcgcggtctttccagtactcttggatcggaaacccgtcggcctccgaacggtactccgccaccgagggacctgagcgagtccgcatcgaccggatcggaaaacctctcgagaaaggcgtctaaccagtcacagtcgcaaggtaggctgagcaccgtggcgggcggcagcgggtggcggtcggggttgtttctggcggaggtgctgctgatgatgtaattaaagtaggcggtcttgagacggcggatggtcgaggtgaggtgtgggtttagtgaaccgtcagatcctcactctcttccgcatcgctgtctgcgagggccagctgtcaggcttgagatccagctgttggggtgagtactccctctcaaaagcgggcattacttctgcgctaagattgtcagtttccaaaaacgaggaggatttgatattcacctggcccgatctggccatacacttgagtgacaatgacatccactttgcctttctctccacaggtgtccactcccaggtccaagtttaaactttaatacgactcactataggggccgccaccaagcttggtaccgctagcggatccgttaaccttaagaccggtatgggctggtcctgcatcatcctgttcctcgtggcgaccgcgaccggggtccacagcgatatcatcgatagcgctcccgg ....... <Complete List of DNA Sequence>

Related Molecule Biology Services

Other Mammalian Expression vectors

Mammalian Expression Vector Construction

Mammalian Expression Vector: pCMV3-N-Flag Mammalian Expression Vector: pCMV3-C-Flag
Mammalian Expression Vector: pCMV3-N-His Mammalian Expression Vector: pCMV3-C-His
Mammalian Expression Vector: pCMV3-N-HA Mammalian Expression Vector: pCMV3-C-HA
Mammalian Expression Vector: pCMV3-N-Myc Mammalian Expression Vector: pCMV3-C-Myc
Mammalian Expression Vector: pCMV3-N-GFPSpark Mammalian Expression Vector: pCMV3-C-GFPSpark
Mammalian Expression Vector: pCMV3-N-OFPSpark Mammalian Expression Vector: pCMV3-C-OFPSpark
Mammalian Expression Vector: pCMV3-untagged  
Biology CRO Service
Biology CRO Service Introduction
Antibody Production & Development CRO Service
Protein Production CRO Service
Transient Transfection Service: Mammalian Cell Culture
Molecular Biology CRO Service
Gene Expression Vector Construction CRO Service+
- Gene Expression Vector Construction Service Description
- Mammalian Cell Expression Vector Construction Service
Mammalian Cell Expression Vector Construction Service Description
Mammalian Expression Vector Construction Service: pCMV3-N-FLAG
Mammalian Expression Vector Construction Service: pCMV3-N-His
Mammalian Expression Vector Construction Service: pCMV3-N-HA
Mammalian Expression Vector Construction Service: pCMV3-N-Myc
Mammalian Expression Vector Construction Service: pCMV3-N-GFPSpark
Mammalian Expression Vector Construction Service: pCMV3-N-OFPSpark
Mammalian Expression Vector Construction Service: pCMV3-C-FLAG
Mammalian Expression Vector Construction Service: pCMV3-C-His
Mammalian Expression Vector Construction Service: pCMV3-C-HA
Mammalian Expression Vector Construction Service: pCMV3-C-Myc
Mammalian Expression Vector Construction Service: pCMV3-C-GFPSpark
Mammalian Expression Vector Construction Service: pCMV3-C-OFP
Mammalian Expression Vector Construction Service: untagged
- Insect Cell /Baculovirus Expression Vector Construction Service
- E. Coli. Expression Vector Construction Service
- Yeast Expression Vector Construction Service