Yeast Expression Vector Construction: pPICZa-C-Myc

Your Most Reliable & Cost-Effective Gene & Vector Supporting Partner


Gene Cloning Gene Synthesis


Expression Vector Construction


Plasmid Production


qPCR Primer Design & Testing

Yeast Expression Vector Construction: pPICZa-N-Myc

Service: Construction of expression vector for Pichia Pastoris Yeast expression system
Required Material : Target protein gene provided by customer or ordered from Sino Biological
Vector Backbone: pPICZa vector optimized for yeast cell expression
DetectionTag: pPICZa vector optimized for yeast cell expression
refer to our Myc-tag antibody
Deliverable: 10ug purified Pichia Pastoris yeast cell expression vector plasmid
Timeline: 1-2 weeks
Price Quote:  

pPICZa-C-Myc Yeast Expression Vector Physical Map

pPICZa-C-Myc Yeast Expression Vector Description

Schematic of cloning site on pPICZa-C-Myc Yeast Expression Vector

pPICZa-C-Myc Yeast Expression Vector Backbone DNA Sequence

agatctaacatccaaagacgaaaggttgaatgaaacctttttgccatccgacatccacaggtccattctcacacataagtgccaaacgcaacaggaggggatacactagcagcagaccgttgcaaacgcaggacctccactcctcttctcctcaacacccacttttgccatcgaaaaaccagcccagttattgggcttgattggagctcgctcattccaattccttctattaggctactaacaccatgactttattagcctgtctatcctggcccccctggcgaggttcatgtttgtttatttccgaatgcaacaagctccgcattacacccgaacatcactccagatgagggctttctgagtgtggggtcaaatagtttcatgttccccaaatggcccaaaactgacagtttaaacgctgtcttggaacctaatatgacaaaagcgtgatctcatccaagatgaactaagtttggttcgttgaaatgctaacggccagttggtcaaaaagaaacttccaaaagtcggcataccgtttgtcttgtttggtattgattgacgaatgctcaaaaataatctcattaatgcttagcgcagtctctctatcgcttctgaaccccggtgcacctgtgccgaaacgcaaatggggaaacacccgctttttggatgattatgcattgtctccacattgtatgcttccaagattctggtgggaata ....... <Complete List of DNA Sequence>

Related Molecule Biology Services

Yeast Expression Vector Construction Service

Yeast Expression Vector: pPICZa-N-Flag Yeast Expression Vector: pPICZa-C-Flag
Yeast Expression Vector: pPICZa-N-His Yeast Expression Vector: pPICZa-C-His
Yeast Expression Vector: pPICZa-N-HA Yeast Expression Vector: pPICZa-C-HA
Yeast Expression Vector: pPICZa-N-Myc Yeast Expression Vector: pPICZa-C-Myc
Yeast Expression Vector: pPICZa-untagged  
Biology CRO Service
Biology CRO Service Introduction
Antibody Production & Development CRO Service
Protein Production CRO Service
Transient Transfection Service: Mammalian Cell Culture
Molecular Biology CRO Service
Gene Expression Vector Construction CRO Service+
- Gene Expression Vector Construction Service Description
- Mammalian Cell Expression Vector Construction Service
- Insect Cell /Baculovirus Expression Vector Construction Service
- E. Coli. Expression Vector Construction Service
- Yeast Expression Vector Construction Service
Yeast Expression Vector Construction Service Description
Yeast Expression Vector Construction: pPICZa-N-Flag
Yeast Expression Vector Construction: pPICZa-N-His
Yeast Expression Vector Construction: pPICZa-N-HA
Yeast Expression Vector Construction: pPICZa-N-Myc
Yeast Expression Vector Construction: untagged
Yeast Expression Vector Construction: pPICZa-C-Flag
Yeast Expression Vector Construction: pPICZa-C-His
Yeast Expression Vector Construction: pPICZa-C-HA
Yeast Expression Vector Construction: pPICZa-C-Myc